Cswrky40
WebNational Center for Biotechnology Information WebStation Address. 1018 Chestnut Street Bowling Green, KY 42101. Mailing Address. PO Box 149 Bowling Green, KY 42102-0149. Phone 270-781-2140. Fax. 270-842-7140
Cswrky40
Did you know?
WebThe CsWRKY40 protein was located in the nucleoplasm, whereas CsPDX2.1 was found in both the nucleoplasm and cytoplasm. Analysis of withering, water-retention, and water-loss treatments confirmed that water loss from tea leaves was the critical factor that affected ABA and L-theanine contents by activating the expression of CsWRKY40 and CsPDX2.1. WebNews 40 @ 6 6P WNKY CBS 40. News 40 @ 10 10P WNKY NBC 40 and WNKY CBS 40.
WebAug 31, 2024 · The L-theanine hydrolase gene and subcellular distribution of ethylamine in tea leaves are identified, to which improves the understanding of the L-Theanine metabolism and the mechanism of differential accumulation of L- theanine among tea varieties. L-Theanine has a significant role in the taste of tea (Camellia sinensis) infusions. Our … WebFeb 19, 2024 · In summary, CsWRKY40 had a significant regulatory effect on the expression of CsPDX2.1. However, whether CsWRKY40 is the main or independent …
WebWRKY transcription factors (TFs) play a vital role in plant stress signal transduction and regulate the expression of various stress resistance genes. Sweet orange (Citrus sinensis) accounts for a large proportion of the world’s citrus industry, which has high economic value, while Penicillium digitatum is a prime pathogenic causing postharvest … WebApr 10, 2024 · Feeding the world: impacts of elevated [CO 2] on nutrient content of greenhouse grown fruit crops and options for future yield gains
WebCsWRKY40 forward: AGACGACGGTTACAGATGGCG reverse:AGTGGTGACGACGATGGAAGG CsWRKY41 forward: GGGGAGGTTGATGAGTTTGTT reverse:GTTCCTTGGATTTGGGCTGTT CsWRKY42 forward: TGGAGGAAATATGGACAAAAG reverse:TTACAACGCTTGAATCTTCAC …
WebOct 3, 2024 · Transcription factor CsWRKY40 regulates L-theanine hydrolysis by activating the CsPDX2.1 promoter in tea leaves during withering. Cheng H, Wu W, Liu X, Wang Y, Xu P. Hortic Res, uhac025, 19 Feb 2024 Cited by: 0 articles PMID: 35184176 PMCID: PMC9055099. Free to read & use jesus name god of possibleWebSep 17, 2024 · Three CsMYB (CsMYB1, CsMYB3 and CsMYB4), two CsMYC (CsbHLH79 and CsbHLH121) and two CsWRKY (CsWRKY40 and CsWRKY44) genes were identified among the 33 TFs. Furthermore, in addition to the seven reported TFs, the remaining 26 novel TFs may play an important role in volatile heterosis. lampl markusWebDec 17, 2024 · News 40 WNKY Television. @wnkytv. Your source for local news, weather and sports in South Central Kentucky. #CBS #NBC #MeTV Watch News 40 weekdays at … jesus name graffitiWebSep 28, 2011 · Background WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the … lamplmair hagenbergWebCsWRKY40 Csa019119 522 522 + CsWRKY41 Csa013101 510 3539 + CsWRKY42 Csa013154 618 2623 + CsWRKY43 Csa010294 GU984031 546 2318 1 + + CsWRKY44 … lamp lm betekenisWebTranscription factor CsWRKY40 regulates L-theanine hydrolysis by activating the CsPDX2.1 promoter in tea leaves during withering … lamp ln72sWebAug 26, 2015 · CsWRKY40 gene rapidly increased at 4 h and then decreased at 12 h; however, CsWRKY40 gene was initially downregulated in Tea_T1. The relative … lamp lm